Transcript: Mouse NM_001163136.1

Mus musculus metastasis associated in colon cancer 1 (Macc1), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Macc1 (238455)
Length:
3818
CDS:
1..2556

Additional Resources:

NCBI RefSeq record:
NM_001163136.1
NBCI Gene record:
Macc1 (238455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341495 ACACATCTCCAGTCGTATTTC pLKO_005 1232 CDS 100% 13.200 10.560 N Macc1 n/a
2 TRCN0000341426 ATCCACCAGCTGCTACTATTT pLKO_005 1067 CDS 100% 13.200 9.240 N Macc1 n/a
3 TRCN0000341430 CAAGGAGGGTCAGTCCAATTA pLKO_005 661 CDS 100% 13.200 9.240 N Macc1 n/a
4 TRCN0000341427 CCGACTCAGACATCACTATTC pLKO_005 683 CDS 100% 10.800 7.560 N Macc1 n/a
5 TRCN0000341428 TACCCATGAGGCTAGTGTAAA pLKO_005 2714 3UTR 100% 0.000 0.000 N Macc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.