Transcript: Mouse NM_001164312.1

Mus musculus predicted gene 4847 (Gm4847), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gm4847 (226604)
Length:
3012
CDS:
201..1814

Additional Resources:

NCBI RefSeq record:
NM_001164312.1
NBCI Gene record:
Gm4847 (226604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367023 CACAGTCTTCACTCGTTATAA pLKO_005 902 CDS 100% 15.000 21.000 N Gm4847 n/a
2 TRCN0000376207 ACTAACCTCATATTGACATAG pLKO_005 1810 CDS 100% 10.800 15.120 N Gm4847 n/a
3 TRCN0000377175 GGTCTGGGATGACCTTATATT pLKO_005 2295 3UTR 100% 15.000 10.500 N Gm4847 n/a
4 TRCN0000367022 GTCGACTACATGGACGAAATT pLKO_005 1497 CDS 100% 13.200 9.240 N Gm4847 n/a
5 TRCN0000376205 ACTACACTGAGAAGTACTTTC pLKO_005 649 CDS 100% 10.800 7.560 N Gm4847 n/a
6 TRCN0000367025 ATGGATATGGAATCGAGTTTG pLKO_005 857 CDS 100% 10.800 7.560 N Gm4847 n/a
7 TRCN0000376150 TACCTAATGAAACCATATATC pLKO_005 1858 3UTR 100% 0.000 0.000 N Gm4847 n/a
8 TRCN0000367024 ACCTGCCAAATCGCATCATTA pLKO_005 1063 CDS 100% 13.200 6.600 Y Gm4847 n/a
9 TRCN0000367294 ACCTGCCAAATCGCATCATTT pLKO_005 1063 CDS 100% 13.200 6.600 Y Gm4846 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.