Transcript: Mouse NM_001164316.1

Mus musculus coiled-coil serine rich 1 (Ccser1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccser1 (232035)
Length:
5602
CDS:
319..3006

Additional Resources:

NCBI RefSeq record:
NM_001164316.1
NBCI Gene record:
Ccser1 (232035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367270 GCATTGGCTGAACGCTTTAAA pLKO_005 1519 CDS 100% 15.000 21.000 N Ccser1 n/a
2 TRCN0000420884 GTCTCCCGGTTGCCAATATTC pLKO_005 352 CDS 100% 13.200 18.480 N CCSER1 n/a
3 TRCN0000367343 GCTGGCTTATGTAATCTATAA pLKO_005 3235 3UTR 100% 13.200 10.560 N Ccser1 n/a
4 TRCN0000367341 ATACCGAGAAGGAAGATATAT pLKO_005 1659 CDS 100% 15.000 10.500 N Ccser1 n/a
5 TRCN0000367269 AGTGATCCAGAGACCCATTTA pLKO_005 1396 CDS 100% 13.200 9.240 N Ccser1 n/a
6 TRCN0000367268 GTTTGCTTCAAGAGTAGATAA pLKO_005 2427 CDS 100% 13.200 9.240 N Ccser1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.