Transcript: Human NM_001168235.2

Homo sapiens FRAS1 related extracellular matrix 3 (FREM3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FREM3 (166752)
Length:
6729
CDS:
1..6420

Additional Resources:

NCBI RefSeq record:
NM_001168235.2
NBCI Gene record:
FREM3 (166752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430605 GCCAGGAACTAATCGTCATTT pLKO_005 5744 CDS 100% 13.200 18.480 N FREM3 n/a
2 TRCN0000430633 AGGGTCCAGATAAGATCATTA pLKO_005 4945 CDS 100% 13.200 10.560 N FREM3 n/a
3 TRCN0000437576 AGGTCCAACCAGTGGATATAC pLKO_005 2081 CDS 100% 13.200 10.560 N FREM3 n/a
4 TRCN0000432116 GTACTGTCATTGGTGTTATAT pLKO_005 6523 3UTR 100% 15.000 10.500 N FREM3 n/a
5 TRCN0000431289 ATGAACCACCAATGGTCAATA pLKO_005 1622 CDS 100% 13.200 9.240 N FREM3 n/a
6 TRCN0000420768 TACTGAGTGCTACTGATATTG pLKO_005 1697 CDS 100% 13.200 9.240 N FREM3 n/a
7 TRCN0000417747 ACTATTCTGGCTGATCGTTAT pLKO_005 6004 CDS 100% 10.800 7.560 N FREM3 n/a
8 TRCN0000420132 ATGTCACCATTGGCAACTTAG pLKO_005 4247 CDS 100% 10.800 7.560 N FREM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.