Transcript: Mouse NM_001170789.1

Mus musculus leucine rich repeat containing 36 (Lrrc36), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lrrc36 (270091)
Length:
2108
CDS:
60..1970

Additional Resources:

NCBI RefSeq record:
NM_001170789.1
NBCI Gene record:
Lrrc36 (270091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267594 GACACGGGTCAGTACCTAATA pLKO_005 1905 CDS 100% 13.200 18.480 N Lrrc36 n/a
2 TRCN0000253151 TTCCGACTAAGAGGTCATTAA pLKO_005 1075 CDS 100% 13.200 18.480 N Lrrc36 n/a
3 TRCN0000267623 GCGCTCGAAGCTTGACGATAA pLKO_005 1415 CDS 100% 10.800 15.120 N Lrrc36 n/a
4 TRCN0000253152 AGGTCCCTGGTGGTAACTAAT pLKO_005 1743 CDS 100% 13.200 9.240 N Lrrc36 n/a
5 TRCN0000253150 CTACCGAGAACATAGCATAAA pLKO_005 770 CDS 100% 13.200 9.240 N Lrrc36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.