Transcript: Mouse NM_001177404.1

Mus musculus zinc finger protein 967 (Zfp967), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Zfp967 (100303732)
Length:
1811
CDS:
53..469

Additional Resources:

NCBI RefSeq record:
NM_001177404.1
NBCI Gene record:
Zfp967 (100303732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240261 TACGAAGGCATCTAATGTTAT pLKO_005 229 CDS 100% 13.200 6.600 Y Zfp966 n/a
2 TRCN0000242348 ACATACAATTGAAGACCATTT pLKO_005 129 CDS 100% 10.800 5.400 Y Gm14393 n/a
3 TRCN0000239453 CATACAATTGAAGACCATTTC pLKO_005 130 CDS 100% 10.800 5.400 Y Gm14288 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.