Transcript: Human NM_001197100.1

Homo sapiens IQ motif containing J (IQCJ), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
IQCJ (654502)
Length:
1484
CDS:
182..580

Additional Resources:

NCBI RefSeq record:
NM_001197100.1
NBCI Gene record:
IQCJ (654502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255724 GTGAATGGACCTCAAGTTTAT pLKO_005 577 CDS 100% 13.200 10.560 N IQCJ n/a
2 TRCN0000255802 TAACAACCATGAGTCCATTTG pLKO_005 662 3UTR 100% 10.800 8.640 N IQCJ n/a
3 TRCN0000255723 ACCCACTGGGTTCATACATAC pLKO_005 511 CDS 100% 10.800 7.560 N IQCJ n/a
4 TRCN0000255721 ATCCTCTAGAACAAGTTAATG pLKO_005 213 CDS 100% 13.200 6.600 Y IQCJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.