Transcript: Human NM_001198908.2

Homo sapiens coiled-coil domain containing 169 (CCDC169), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CCDC169 (728591)
Length:
6018
CDS:
96..821

Additional Resources:

NCBI RefSeq record:
NM_001198908.2
NBCI Gene record:
CCDC169 (728591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198908.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350859 CCGTACATACCTAGCTGAAAT pLKO_005 536 CDS 100% 13.200 6.600 Y CCDC169 n/a
2 TRCN0000337301 CTCTTGAAAGTCAAGTGAAAT pLKO_005 457 CDS 100% 13.200 6.600 Y CCDC169 n/a
3 TRCN0000337241 GGTTTACATCAAGTTTCTAAA pLKO_005 570 CDS 100% 13.200 6.600 Y CCDC169 n/a
4 TRCN0000337302 GGCTTACCAGAAGATCAACAA pLKO_005 509 CDS 100% 4.950 2.475 Y CCDC169 n/a
5 TRCN0000337242 CAACTGCCTAGGATGCAAGAG pLKO_005 606 CDS 100% 4.050 2.025 Y CCDC169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198908.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.