Transcript: Mouse NM_001285916.1

Mus musculus geminin coiled-coil domain containing (Gmnc), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gmnc (239789)
Length:
4448
CDS:
403..1404

Additional Resources:

NCBI RefSeq record:
NM_001285916.1
NBCI Gene record:
Gmnc (239789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267221 ATGTAGGGTGAACCTTATATA pLKO_005 2528 3UTR 100% 15.000 21.000 N Gmnc n/a
2 TRCN0000267223 AGAGTTATAATTGCCCGTATT pLKO_005 449 CDS 100% 10.800 8.640 N Gmnc n/a
3 TRCN0000267220 TCGCCCTCTGAGTTAAGTTTC pLKO_005 583 CDS 100% 10.800 8.640 N Gmnc n/a
4 TRCN0000337200 AGCCTTTGTGCGTCGAGATGA pLKO_005 1341 CDS 100% 4.950 3.960 N GMNC n/a
5 TRCN0000267219 TGCCTTGCCAAGATCAGTATT pLKO_005 416 CDS 100% 13.200 9.240 N Gmnc n/a
6 TRCN0000267222 GAGATCTACACCTCGACTATG pLKO_005 1115 CDS 100% 10.800 7.560 N Gmnc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.