Transcript: Human NM_001286646.1

Homo sapiens solute carrier family 45 member 4 (SLC45A4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
SLC45A4 (57210)
Length:
7243
CDS:
401..2827

Additional Resources:

NCBI RefSeq record:
NM_001286646.1
NBCI Gene record:
SLC45A4 (57210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253926 ACGAGACCTTGCTGGATAATC pLKO_005 1509 CDS 100% 13.200 10.560 N SLC45A4 n/a
2 TRCN0000253923 CGTTCTGGTTTCAACGAATAA pLKO_005 3451 3UTR 100% 13.200 10.560 N SLC45A4 n/a
3 TRCN0000253924 CCACATTCCTGGTGATCTATC pLKO_005 2529 CDS 100% 10.800 7.560 N SLC45A4 n/a
4 TRCN0000253925 CTGTCAGATCTCGTCACATTG pLKO_005 2722 CDS 100% 10.800 7.560 N SLC45A4 n/a
5 TRCN0000252031 ATGAAGCTAAAGTCCCAAATG pLKO_005 1536 CDS 100% 10.800 7.560 N Slc45a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.