Transcript: Human NM_001290097.2

Homo sapiens transmembrane protein 114 (TMEM114), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM114 (283953)
Length:
1217
CDS:
516..944

Additional Resources:

NCBI RefSeq record:
NM_001290097.2
NBCI Gene record:
TMEM114 (283953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336643 TCAGCGTCTACATAGCGTATT pLKO_005 733 CDS 100% 10.800 15.120 N TMEM114 n/a
2 TRCN0000336578 GAACGTGACAGTCAGCGAATC pLKO_005 536 CDS 100% 6.000 8.400 N TMEM114 n/a
3 TRCN0000377564 CTTCACCGACCGATCTCCATC pLKO_005 992 3UTR 100% 1.350 1.890 N TMEM114 n/a
4 TRCN0000370764 TCAGCCTGATCCTGATGGTTT pLKO_005 607 CDS 100% 4.950 3.465 N TMEM114 n/a
5 TRCN0000377565 TCCTGGACCAGGTGGACATCA pLKO_005 802 CDS 100% 1.650 1.155 N TMEM114 n/a
6 TRCN0000336642 TGCGGCCTCTTCTTCCTCAAA pLKO_005 1016 3UTR 100% 4.950 2.970 N TMEM114 n/a
7 TRCN0000377563 TCCTCTTTGGAGCCATGGTGA pLKO_005 700 CDS 100% 2.640 1.584 N TMEM114 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.