Transcript: Mouse NM_001301351.1

Mus musculus caprin family member 2 (Caprin2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Caprin2 (232560)
Length:
3053
CDS:
264..2699

Additional Resources:

NCBI RefSeq record:
NM_001301351.1
NBCI Gene record:
Caprin2 (232560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253269 TTCAGCTTGGTAGATTCAATT pLKO_005 2410 CDS 100% 13.200 10.560 N Caprin2 n/a
2 TRCN0000253270 AGTGGTAGGAACAACATATAA pLKO_005 896 CDS 100% 15.000 10.500 N Caprin2 n/a
3 TRCN0000253271 ATTGCTGCACTCAGGTTATTT pLKO_005 941 CDS 100% 15.000 10.500 N Caprin2 n/a
4 TRCN0000253267 TTACTCTCAAAGGGATAATTT pLKO_005 2057 CDS 100% 15.000 10.500 N Caprin2 n/a
5 TRCN0000253268 AGCAGTCCTTGCCCTAGTGAT pLKO_005 2751 3UTR 100% 4.950 3.465 N Caprin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.