Transcript: Mouse NM_001303132.1

Mus musculus retinal degeneration 3 (Rd3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rd3 (74023)
Length:
3857
CDS:
561..878

Additional Resources:

NCBI RefSeq record:
NM_001303132.1
NBCI Gene record:
Rd3 (74023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001303132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247163 CCAGTGACATCCGAACCATCT pLKO_005 978 3UTR 100% 4.050 5.670 N Rd3 n/a
2 TRCN0000257733 CCCACATACTCATCCCAATTT pLKO_005 1306 3UTR 100% 13.200 9.240 N Rd3 n/a
3 TRCN0000247164 GACTACAGCTGGTTGGCAAAC pLKO_005 735 CDS 100% 6.000 4.200 N Rd3 n/a
4 TRCN0000247165 CCATAAGCTGACACGTCAGTG pLKO_005 895 3UTR 100% 4.050 2.835 N Rd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.