Transcript: Human NM_001308305.2

Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 (AGAP3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
AGAP3 (116988)
Length:
2715
CDS:
134..1864

Additional Resources:

NCBI RefSeq record:
NM_001308305.2
NBCI Gene record:
AGAP3 (116988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437542 GGTAGTGGCCTTGCGAAAGAA pLKO_005 1525 CDS 100% 5.625 7.875 N AGAP3 n/a
2 TRCN0000444944 GTTCAGCCTGGAGGATGAAAT pLKO_005 1270 CDS 100% 13.200 9.240 N Agap3 n/a
3 TRCN0000440510 TGAAGCGGTGCACCTACTATG pLKO_005 1446 CDS 100% 10.800 7.560 N AGAP3 n/a
4 TRCN0000438806 ACATCAACCAGGCCACGAATG pLKO_005 1632 CDS 100% 6.000 4.200 N AGAP3 n/a
5 TRCN0000429939 GAGCTTAAAGTGGGCATAGTG pLKO_005 1052 CDS 100% 4.950 3.465 N AGAP3 n/a
6 TRCN0000421896 TCAGTTTCCAGACGGTGTACA pLKO_005 1290 CDS 100% 4.950 3.465 N AGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.