Transcript: Mouse NM_001308448.1

Mus musculus SECIS binding protein 2 (Secisbp2), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-12-25
Taxon:
Mus musculus (mouse)
Gene:
Secisbp2 (75420)
Length:
3322
CDS:
265..2649

Additional Resources:

NCBI RefSeq record:
NM_001308448.1
NBCI Gene record:
Secisbp2 (75420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253078 CCTTCGTGTTTGCACTCAATC pLKO_005 2258 CDS 100% 10.800 15.120 N Secisbp2 n/a
2 TRCN0000253077 TTGGACACCAATGGGTTATAT pLKO_005 966 CDS 100% 15.000 12.000 N Secisbp2 n/a
3 TRCN0000253075 GAGAAGTCTAAACCGAGTTAT pLKO_005 1228 CDS 100% 13.200 10.560 N Secisbp2 n/a
4 TRCN0000253076 CTTTACTGACATGATGTATTT pLKO_005 2722 3UTR 100% 13.200 9.240 N Secisbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.