Transcript: Human NM_001319099.1

Homo sapiens EFR3 homolog B (EFR3B), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
EFR3B (22979)
Length:
7488
CDS:
303..2651

Additional Resources:

NCBI RefSeq record:
NM_001319099.1
NBCI Gene record:
EFR3B (22979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231064 AGGATCTAACACCTAATATTG pLKO_005 3672 3UTR 100% 13.200 18.480 N EFR3B n/a
2 TRCN0000253683 TTAGGTAGACACTAGGTTTAA pLKO_005 6611 3UTR 100% 13.200 18.480 N EFR3B n/a
3 TRCN0000231061 TTCGAATGTCAGGCATCAAAG pLKO_005 685 CDS 100% 10.800 15.120 N EFR3B n/a
4 TRCN0000253684 GAACCGTCTGACCCAGATTAT pLKO_005 1466 CDS 100% 13.200 10.560 N EFR3B n/a
5 TRCN0000231063 GACAGATGAGGATCGTTTATC pLKO_005 2243 CDS 100% 13.200 9.240 N EFR3B n/a
6 TRCN0000253686 ATGCAGAAATTCGACTCTTTG pLKO_005 1597 CDS 100% 10.800 7.560 N EFR3B n/a
7 TRCN0000218376 CCGTCTATGAAATGAAGTTTC pLKO_005 2611 CDS 100% 10.800 7.560 N EFR3B n/a
8 TRCN0000253682 GGACCCACAGCACATGGATAA pLKO_005 761 CDS 100% 10.800 7.560 N EFR3B n/a
9 TRCN0000231062 TGGTGAGGAAGACGGTGAATG pLKO_005 718 CDS 100% 10.800 7.560 N EFR3B n/a
10 TRCN0000253685 ACCGGAGCTATGACTTCTTTG pLKO_005 604 CDS 100% 10.800 6.480 N EFR3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.