Transcript: Human NM_001320340.1

Homo sapiens small VCP interacting protein (SVIP), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
SVIP (258010)
Length:
3313
CDS:
218..457

Additional Resources:

NCBI RefSeq record:
NM_001320340.1
NBCI Gene record:
SVIP (258010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262143 TAGATGTTCAATCTGTGCAAG pLKO_005 348 CDS 100% 4.050 5.670 N SVIP n/a
2 TRCN0000262142 TTAGGTGGACAGTTTCATAAA pLKO_005 438 CDS 100% 13.200 10.560 N SVIP n/a
3 TRCN0000262144 ATAATCTGGATGGGTTATAAT pLKO_005 1206 3UTR 100% 15.000 10.500 N SVIP n/a
4 TRCN0000262141 TAAAGCATAACATGAGTAGAA pLKO_005 455 CDS 100% 4.950 3.465 N SVIP n/a
5 TRCN0000282120 CACCAGAAGGTGGACTTAGGT pLKO_005 423 CDS 100% 3.000 2.100 N SVIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.