Transcript: Human NM_001323580.2

Homo sapiens intraflagellar transport 52 (IFT52), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
IFT52 (51098)
Length:
1872
CDS:
771..1556

Additional Resources:

NCBI RefSeq record:
NM_001323580.2
NBCI Gene record:
IFT52 (51098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244797 CAGATTTGACACCAATATTAA pLKO_005 378 5UTR 100% 15.000 10.500 N IFT52 n/a
2 TRCN0000244795 CTCCTCCTCTGGAGCTATTTG pLKO_005 1285 CDS 100% 13.200 9.240 N IFT52 n/a
3 TRCN0000244796 GAATATGGAATCATGGTTAAT pLKO_005 412 5UTR 100% 13.200 9.240 N IFT52 n/a
4 TRCN0000244799 TCACATGTTCAGTGATCAATA pLKO_005 890 CDS 100% 13.200 9.240 N IFT52 n/a
5 TRCN0000244798 GACCATGCCTCTTGAAGCTTT pLKO_005 1558 3UTR 100% 4.950 3.465 N IFT52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.