Transcript: Mouse NM_001324517.1

Mus musculus predicted gene 5767 (Gm5767), mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Gm5767 (436336)
Length:
545
CDS:
102..491

Additional Resources:

NCBI RefSeq record:
NM_001324517.1
NBCI Gene record:
Gm5767 (436336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001324517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239621 CATGACAGTGACCACCTATAC pLKO_005 308 CDS 100% 10.800 7.560 N Gm5767 n/a
2 TRCN0000239625 TGCTGTGCAGTGGCCTCTTTG pLKO_005 349 CDS 100% 3.600 2.520 N Gm5767 n/a
3 TRCN0000239622 GTTCACTGGCATACCTTATAT pLKO_005 236 CDS 100% 15.000 9.000 N Gm5767 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.