Transcript: Human NM_001345927.2

Homo sapiens DExD/H-box 60 like (DDX60L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
DDX60L (91351)
Length:
6762
CDS:
227..5350

Additional Resources:

NCBI RefSeq record:
NM_001345927.2
NBCI Gene record:
DDX60L (91351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218168 TGCAGGACTTGCATCATATTT pLKO_005 4486 CDS 100% 15.000 12.000 N DDX60L n/a
2 TRCN0000230589 AGGCGTATCAGACTCTATTTC pLKO_005 948 CDS 100% 13.200 9.240 N DDX60L n/a
3 TRCN0000230591 ATACCCTGTGAACCCGAATAT pLKO_005 6360 3UTR 100% 13.200 9.240 N DDX60L n/a
4 TRCN0000230590 TATTACCGCGAGTGCGATTTA pLKO_005 3900 CDS 100% 13.200 9.240 N DDX60L n/a
5 TRCN0000217946 TTGACATCATGTGCAAGTAAT pLKO_005 2060 CDS 100% 13.200 9.240 N DDX60L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.