Transcript: Human NM_001346304.2

Homo sapiens inhibitory synaptic factor family member 2B (INSYN2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
INSYN2B (100131897)
Length:
5696
CDS:
1119..2726

Additional Resources:

NCBI RefSeq record:
NM_001346304.2
NBCI Gene record:
INSYN2B (100131897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272468 GAACACGGCGTGCATCATATA pLKO_005 2516 CDS 100% 13.200 18.480 N INSYN2B n/a
2 TRCN0000272412 CTTCTGACCTTGCCTACTTAA pLKO_005 1552 CDS 100% 13.200 10.560 N INSYN2B n/a
3 TRCN0000272467 TTCAGGTTCCAGATGATATTT pLKO_005 1723 CDS 100% 15.000 10.500 N INSYN2B n/a
4 TRCN0000272457 TTCCCATCCTGGGTTCATAAA pLKO_005 3080 3UTR 100% 13.200 9.240 N INSYN2B n/a
5 TRCN0000272469 AGGTCAGCTGAAGTAAGTAAC pLKO_005 1791 CDS 100% 10.800 7.560 N INSYN2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.