Transcript: Human NM_001352012.1

Homo sapiens solute carrier family 35 member F4 (SLC35F4), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
SLC35F4 (341880)
Length:
2051
CDS:
447..1838

Additional Resources:

NCBI RefSeq record:
NM_001352012.1
NBCI Gene record:
SLC35F4 (341880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253760 GGCTTAGAGAGGGACATATTT pLKO_005 1832 CDS 100% 15.000 10.500 N SLC35F4 n/a
2 TRCN0000253761 CCTAAAGCAGGAGGTGATATT pLKO_005 1607 CDS 100% 13.200 9.240 N SLC35F4 n/a
3 TRCN0000253759 CTATGGACTTTGACTAATTAC pLKO_005 1044 CDS 100% 13.200 9.240 N SLC35F4 n/a
4 TRCN0000265453 CACGTGTATGTATATTCTGTG pLKO_005 1859 3UTR 100% 4.050 2.835 N SLC35F4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.