Transcript: Human NM_001354595.1

Homo sapiens methyltransferase like 24 (METTL24), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
METTL24 (728464)
Length:
2780
CDS:
220..729

Additional Resources:

NCBI RefSeq record:
NM_001354595.1
NBCI Gene record:
METTL24 (728464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270156 AGGAAGTGATGATACCCATTT pLKO_005 189 5UTR 100% 10.800 7.560 N METTL24 n/a
2 TRCN0000269816 GTGTCAAGTCAGCTCACATTC pLKO_005 260 CDS 100% 10.800 7.560 N METTL24 n/a
3 TRCN0000269755 CTGGAGGTTCCTGAGATATAT pLKO_005 152 5UTR 100% 15.000 9.000 N METTL24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.