Transcript: Mouse NM_001368162.1

Mus musculus maestro heat-like repeat family member 5 (Mroh5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-01-18
Taxon:
Mus musculus (mouse)
Gene:
Mroh5 (268816)
Length:
2251
CDS:
198..1481

Additional Resources:

NCBI RefSeq record:
NM_001368162.1
NBCI Gene record:
Mroh5 (268816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001368162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341391 CCACGGAACTGAATGATATAT pLKO_005 229 CDS 100% 15.000 21.000 N Mroh5 n/a
2 TRCN0000341336 CTGCCTGGGTCACTACTATTC pLKO_005 1776 3UTR 100% 10.800 15.120 N Mroh5 n/a
3 TRCN0000341330 GTTCACCTACTACGGGCTAAT pLKO_005 563 CDS 100% 10.800 15.120 N Mroh5 n/a
4 TRCN0000352591 ATGTGATGGGAGTCCTAATAT pLKO_005 367 CDS 100% 15.000 10.500 N Mroh5 n/a
5 TRCN0000341394 ACACGGTCCATGATCACTTTG pLKO_005 1453 CDS 100% 10.800 7.560 N Mroh5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.