Transcript: Human NM_001370416.1

Homo sapiens cortexin 2 (CTXN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
CTXN2 (399697)
Length:
2922
CDS:
465..710

Additional Resources:

NCBI RefSeq record:
NM_001370416.1
NBCI Gene record:
CTXN2 (399697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353053 CGTGAGAGTTCCAGCTATATG pLKO_005 706 CDS 100% 13.200 18.480 N CTXN2 n/a
2 TRCN0000344447 GATGAGTGTCAACGAAGTATC pLKO_005 500 CDS 100% 10.800 15.120 N CTXN2 n/a
3 TRCN0000371211 ATCCTGCTAGACCCATATAGT pLKO_005 615 CDS 100% 5.625 7.875 N CTXN2 n/a
4 TRCN0000344384 CTTCTTGGGACTTCTTATTAT pLKO_005 581 CDS 100% 15.000 10.500 N CTXN2 n/a
5 TRCN0000371212 TTCCTTTCTTGTGCTAATAAA pLKO_005 994 3UTR 100% 15.000 10.500 N CTXN2 n/a
6 TRCN0000344448 GGACACATTCTGGATACAATT pLKO_005 748 3UTR 100% 13.200 9.240 N CTXN2 n/a
7 TRCN0000371210 CCTCTACATGGGAAGATGAAG pLKO_005 646 CDS 100% 4.950 3.465 N CTXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.