Transcript: Human NM_001371284.1

Homo sapiens zinc finger and BTB domain containing 7C (ZBTB7C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
ZBTB7C (201501)
Length:
5164
CDS:
717..2576

Additional Resources:

NCBI RefSeq record:
NM_001371284.1
NBCI Gene record:
ZBTB7C (201501)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235016 TATCACATCCAGCTCTATATT pLKO_005 3365 3UTR 100% 15.000 21.000 N ZBTB7C n/a
2 TRCN0000235015 AGAACGACTACGGTGCCTATC pLKO_005 1699 CDS 100% 6.000 8.400 N ZBTB7C n/a
3 TRCN0000235012 ACGTCTATGAGATCGACTTTG pLKO_005 934 CDS 100% 10.800 7.560 N ZBTB7C n/a
4 TRCN0000235013 ATGATGACACGGAGGACTTTG pLKO_005 1210 CDS 100% 10.800 7.560 N ZBTB7C n/a
5 TRCN0000235014 TCTCACAGAGAAGGCCTATTC pLKO_005 1298 CDS 100% 10.800 7.560 N ZBTB7C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.