Transcript: Mouse NM_008305.3

Mus musculus perlecan (heparan sulfate proteoglycan 2) (Hspg2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hspg2 (15530)
Length:
14201
CDS:
60..13211

Additional Resources:

NCBI RefSeq record:
NM_008305.3
NBCI Gene record:
Hspg2 (15530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246980 TATCCAGATTACGGGCAATAA pLKO_005 4361 CDS 100% 13.200 18.480 N Hspg2 n/a
2 TRCN0000246981 AGCCTGACAGTGTCGAGTATA pLKO_005 13250 3UTR 100% 13.200 9.240 N Hspg2 n/a
3 TRCN0000246982 AGCTGATCTCTACCCACTTTG pLKO_005 4084 CDS 100% 10.800 7.560 N Hspg2 n/a
4 TRCN0000257750 GAAGGCCTGAGTTTCGATTTG pLKO_005 11230 CDS 100% 10.800 7.560 N Hspg2 n/a
5 TRCN0000257584 TGCCAACAAGGCGCTGGATAT pLKO_005 12561 CDS 100% 10.800 7.560 N Hspg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.