Transcript: Human NM_014831.3

Homo sapiens tetratricopeptide repeat and ankyrin repeat containing 1 (TRANK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TRANK1 (9881)
Length:
10479
CDS:
246..9023

Additional Resources:

NCBI RefSeq record:
NM_014831.3
NBCI Gene record:
TRANK1 (9881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230568 ATAGTCCGTGGCCTCTATTAT pLKO_005 8088 CDS 100% 15.000 21.000 N TRANK1 n/a
2 TRCN0000230569 TTGGCTGGCAGGCCTTATAAG pLKO_005 10027 3UTR 100% 13.200 18.480 N TRANK1 n/a
3 TRCN0000218453 TTAGCACTTGTGCTAACAATT pLKO_005 4917 CDS 100% 1.320 1.848 N TRANK1 n/a
4 TRCN0000230567 ATGACCCTGGGCCCATATTAA pLKO_005 6508 CDS 100% 15.000 10.500 N TRANK1 n/a
5 TRCN0000230566 TACTGATTCTGAGGCTTATAA pLKO_005 4988 CDS 100% 15.000 10.500 N TRANK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.