Transcript: Human NM_015325.3

Homo sapiens interactor of little elongation complex ELL subunit 1 (ICE1), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ICE1 (23379)
Length:
7930
CDS:
240..7040

Additional Resources:

NCBI RefSeq record:
NM_015325.3
NBCI Gene record:
ICE1 (23379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264171 TACTAAGTGGACACGAATTAA pLKO_005 1928 CDS 100% 15.000 21.000 N ICE1 n/a
2 TRCN0000264170 CTCAAGATGTAGTGCGTAATT pLKO_005 7529 3UTR 100% 13.200 18.480 N ICE1 n/a
3 TRCN0000264169 GCCTAATCAAGTATCAGTTAT pLKO_005 2801 CDS 100% 13.200 10.560 N ICE1 n/a
4 TRCN0000264172 ACCCGTTAAGCCTAGTATATG pLKO_005 4778 CDS 100% 13.200 9.240 N ICE1 n/a
5 TRCN0000264168 ATAAGAGTCGTTTGCGAAATA pLKO_005 4756 CDS 100% 13.200 9.240 N ICE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.