Transcript: Human NM_015351.2

Homo sapiens tetratricopeptide repeat domain 9 (TTC9), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TTC9 (23508)
Length:
5094
CDS:
215..883

Additional Resources:

NCBI RefSeq record:
NM_015351.2
NBCI Gene record:
TTC9 (23508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247690 ACCAACGTGATTCGGTATATC pLKO_005 806 CDS 100% 13.200 18.480 N TTC9 n/a
2 TRCN0000247689 TCCGTGAAGCCATAGGCAAAT pLKO_005 432 CDS 100% 10.800 15.120 N TTC9 n/a
3 TRCN0000247693 TACCAATGACACCGTTAATTT pLKO_005 2277 3UTR 100% 0.000 0.000 N TTC9 n/a
4 TRCN0000247692 TGAACGAGTCAAGGAATATTG pLKO_005 652 CDS 100% 13.200 10.560 N TTC9 n/a
5 TRCN0000252294 AGTGCTACAAGGACAAGAAAT pLKO_005 411 CDS 100% 13.200 9.240 N Ttc9 n/a
6 TRCN0000247691 GGAGAACTTCAAGGCCCTTTA pLKO_005 697 CDS 100% 10.800 7.560 N TTC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.