Transcript: Mouse NM_019781.2

Mus musculus peroxisomal biogenesis factor 14 (Pex14), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pex14 (56273)
Length:
1942
CDS:
6..1136

Additional Resources:

NCBI RefSeq record:
NM_019781.2
NBCI Gene record:
Pex14 (56273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247172 AGGCTCCCGATGGCGAGATTA pLKO_005 311 CDS 100% 4.400 6.160 N Pex14 n/a
2 TRCN0000247173 CGCTTGCTGTGTCGTGGTTTA pLKO_005 1738 3UTR 100% 10.800 8.640 N Pex14 n/a
3 TRCN0000247176 ATCATGGCAGGAATTGCATTT pLKO_005 348 CDS 100% 10.800 7.560 N Pex14 n/a
4 TRCN0000247174 TAATGAGCTCAAGTCGGAAAT pLKO_005 632 CDS 100% 10.800 7.560 N Pex14 n/a
5 TRCN0000247175 AGGACTGACAGACGAAGAGAT pLKO_005 173 CDS 100% 4.950 3.465 N Pex14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.