Transcript: Mouse NM_021408.3

Mus musculus usherin (Ush2a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ush2a (22283)
Length:
15891
CDS:
197..15778

Additional Resources:

NCBI RefSeq record:
NM_021408.3
NBCI Gene record:
Ush2a (22283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248066 GTGGACTCAAATGGTATAATT pLKO_005 3986 CDS 100% 15.000 21.000 N Ush2a n/a
2 TRCN0000248065 TTCGCAGCCTACGAGATTATA pLKO_005 6506 CDS 100% 15.000 21.000 N Ush2a n/a
3 TRCN0000248068 AGGTTCACAACGTACGAATAT pLKO_005 8849 CDS 100% 13.200 18.480 N Ush2a n/a
4 TRCN0000248067 GGTCCTATCATTCACTATATT pLKO_005 10757 CDS 100% 15.000 10.500 N Ush2a n/a
5 TRCN0000248064 TCGCTGCAATTTCGGATTTAA pLKO_005 2368 CDS 100% 15.000 10.500 N Ush2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.