Transcript: Human NM_021982.3

Homo sapiens SEC24 homolog A, COPII coat complex component (SEC24A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SEC24A (10802)
Length:
6389
CDS:
293..3574

Additional Resources:

NCBI RefSeq record:
NM_021982.3
NBCI Gene record:
SEC24A (10802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253657 TTGATGTAAAGCGACTAATAT pLKO_005 5685 3UTR 100% 15.000 21.000 N SEC24A n/a
2 TRCN0000265418 GAGCCGAAGTGTTGGATATTC pLKO_005 1144 CDS 100% 13.200 9.240 N SEC24A n/a
3 TRCN0000253655 GTATCTGGAAATACAAGTTTA pLKO_005 773 CDS 100% 13.200 9.240 N SEC24A n/a
4 TRCN0000253658 TGTCAACCAAGAAGGTATTAC pLKO_005 1018 CDS 100% 13.200 9.240 N SEC24A n/a
5 TRCN0000413636 ACTTATGTTATCGAGTCAATG pLKO_005 1650 CDS 100% 10.800 7.560 N Sec24a n/a
6 TRCN0000253656 TCCCTTAGGTGCTAATCATTT pLKO_005 1273 CDS 100% 13.200 7.920 N SEC24A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021982.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.