Transcript: Mouse NM_022311.2

Mus musculus t-complex-associated testis expressed 2 (Tcte2), mRNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Tcte2 (21646)
Length:
1434
CDS:
117..356

Additional Resources:

NCBI RefSeq record:
NM_022311.2
NBCI Gene record:
Tcte2 (21646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250704 CCGTGTAGATGGAGGTAATAA pLKO_005 554 3UTR 100% 15.000 21.000 N Tcte2 n/a
2 TRCN0000250700 CCAGGTTAGCGACTGAGATTG pLKO_005 341 CDS 100% 10.800 15.120 N Tcte2 n/a
3 TRCN0000250702 GCACGGAGTAACTCAACTAAC pLKO_005 260 CDS 100% 10.800 15.120 N Tcte2 n/a
4 TRCN0000250703 TTGGACACGTTCAAGTGATAC pLKO_005 196 CDS 100% 10.800 8.640 N Tcte2 n/a
5 TRCN0000250701 CTTCGACGTGACTCATCACAG pLKO_005 233 CDS 100% 4.050 2.835 N Tcte2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.