Transcript: Mouse NM_023821.3

Mus musculus cardiomyopathy associated 5 (Cmya5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cmya5 (76469)
Length:
11850
CDS:
219..11249

Additional Resources:

NCBI RefSeq record:
NM_023821.3
NBCI Gene record:
Cmya5 (76469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376852 AGGTCGAGCCAGACGAATTAC pLKO_005 3610 CDS 100% 13.200 18.480 N Cmya5 n/a
2 TRCN0000375651 CAGGAGAGCAAGAGCTTATAA pLKO_005 5032 CDS 100% 15.000 10.500 N Cmya5 n/a
3 TRCN0000366773 CAGTTCCTGCTGAGGTTAATA pLKO_005 6085 CDS 100% 15.000 10.500 N Cmya5 n/a
4 TRCN0000366825 TTCTGGTGAAGAGGATTATTT pLKO_005 8204 CDS 100% 15.000 10.500 N Cmya5 n/a
5 TRCN0000379336 ATTACCTGAGGTCACAGTTAA pLKO_005 6131 CDS 100% 13.200 9.240 N Cmya5 n/a
6 TRCN0000366826 TTACTTCACTAGAGGATAATG pLKO_005 11653 3UTR 100% 13.200 9.240 N Cmya5 n/a
7 TRCN0000375652 GGACTCCAGCTCAAGGTTAAC pLKO_005 10614 CDS 100% 10.800 7.560 N Cmya5 n/a
8 TRCN0000376851 GTCTACCTCAGAGGTGTTAAG pLKO_005 4763 CDS 100% 10.800 7.560 N Cmya5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.