Transcript: Mouse NM_026806.2

Mus musculus kallikrein related-peptidase 5 (Klk5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Klk5 (68668)
Length:
1239
CDS:
48..929

Additional Resources:

NCBI RefSeq record:
NM_026806.2
NBCI Gene record:
Klk5 (68668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255524 GAGTTCGTTAAGTGGATTAAA pLKO_005 888 CDS 100% 15.000 21.000 N Klk5 n/a
2 TRCN0000265669 ACGAGCAGCAGCCACAATAAC pLKO_005 627 CDS 100% 13.200 18.480 N Klk5 n/a
3 TRCN0000255526 CAGTGAAGCCCGTCGAAATTG pLKO_005 553 CDS 100% 13.200 18.480 N Klk5 n/a
4 TRCN0000255527 ACACCATGAACTCCAACTAAT pLKO_005 910 CDS 100% 13.200 9.240 N Klk5 n/a
5 TRCN0000255525 CTCTCCAGAACTTGCTCTATG pLKO_005 1019 3UTR 100% 10.800 7.560 N Klk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.