Transcript: Mouse NM_027018.1

Mus musculus GLI pathogenesis-related 1 like 1 (Glipr1l1), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Glipr1l1 (69286)
Length:
899
CDS:
122..832

Additional Resources:

NCBI RefSeq record:
NM_027018.1
NBCI Gene record:
Glipr1l1 (69286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347493 ACGAATGTCTTGAGGACTATG pLKO_005 405 CDS 100% 10.800 15.120 N Glipr1l1 n/a
2 TRCN0000364038 TCGCCAGCAGGAAACTTTATA pLKO_005 656 CDS 100% 15.000 12.000 N Glipr1l1 n/a
3 TRCN0000347491 ACTATCACGGATCCGAAATTT pLKO_005 224 CDS 100% 15.000 10.500 N Glipr1l1 n/a
4 TRCN0000347494 TGAAATGTGTGGCCATTATAC pLKO_005 538 CDS 100% 13.200 9.240 N Glipr1l1 n/a
5 TRCN0000347573 CCCATAATCCCTGTATCAAAC pLKO_005 378 CDS 100% 10.800 7.560 N Glipr1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.