Transcript: Mouse NM_027308.2

Mus musculus immunoglobulin superfamily, member 23 (Igsf23), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Igsf23 (70080)
Length:
1895
CDS:
236..955

Additional Resources:

NCBI RefSeq record:
NM_027308.2
NBCI Gene record:
Igsf23 (70080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283572 AGGTAAACGCCAACCGATTAC pLKO_005 1501 3UTR 100% 10.800 15.120 N Igsf23 n/a
2 TRCN0000268005 TGCCGAACGCTGAAGACAATC pLKO_005 495 CDS 100% 10.800 15.120 N Igsf23 n/a
3 TRCN0000268056 GAGTCTTCCAAGGGCATAATC pLKO_005 545 CDS 100% 13.200 10.560 N Igsf23 n/a
4 TRCN0000268006 CTGGGAGACGCTTCTACTAAC pLKO_005 277 CDS 100% 10.800 8.640 N Igsf23 n/a
5 TRCN0000268007 GGATCTGTCTGCTTCTATATA pLKO_005 914 CDS 100% 15.000 10.500 N Igsf23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.