Transcript: Mouse NM_027678.3

Mus musculus zinc finger, RAN-binding domain containing 3 (Zranb3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Zranb3 (226409)
Length:
4224
CDS:
227..3436

Additional Resources:

NCBI RefSeq record:
NM_027678.3
NBCI Gene record:
Zranb3 (226409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239047 GGTGCAGTGAAGGACTATATT pLKO_005 1196 CDS 100% 15.000 10.500 N Zranb3 n/a
2 TRCN0000239046 TTCTGGACTGTGTAGTATAAA pLKO_005 3777 3UTR 100% 15.000 10.500 N Zranb3 n/a
3 TRCN0000239044 CTGGTCTTTGCGCACCATTTA pLKO_005 1250 CDS 100% 13.200 9.240 N Zranb3 n/a
4 TRCN0000239045 TGAAGAAGTAAGGCGAGATAT pLKO_005 3426 CDS 100% 13.200 9.240 N Zranb3 n/a
5 TRCN0000239043 TGAATATTCACTACCTTATTG pLKO_005 1545 CDS 100% 13.200 9.240 N Zranb3 n/a
6 TRCN0000430822 TGAATATTCACTACCTTATTG pLKO_005 1545 CDS 100% 13.200 9.240 N ZRANB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.