Transcript: Mouse NM_027944.1

Mus musculus IQ motif containing M (Iqcm), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-31
Taxon:
Mus musculus (mouse)
Gene:
Iqcm (71831)
Length:
2044
CDS:
362..1831

Additional Resources:

NCBI RefSeq record:
NM_027944.1
NBCI Gene record:
Iqcm (71831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347111 TTCGTATCATGGGCCAAATTT pLKO_005 1288 CDS 100% 15.000 21.000 N Iqcm n/a
2 TRCN0000347033 GAAAGATCTGCAACCTATAAA pLKO_005 1045 CDS 100% 15.000 12.000 N Iqcm n/a
3 TRCN0000347030 TTGCTGACAGGACGCTTTATG pLKO_005 912 CDS 100% 13.200 10.560 N Iqcm n/a
4 TRCN0000347112 TCAGCACAGTGCTCCATTAAA pLKO_005 1849 3UTR 100% 15.000 10.500 N Iqcm n/a
5 TRCN0000347032 GGAGCCACATGTGTCGAATAT pLKO_005 685 CDS 100% 13.200 9.240 N Iqcm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.