Transcript: Mouse NM_028182.1

Mus musculus SH2 domain containing 4A (Sh2d4a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sh2d4a (72281)
Length:
2767
CDS:
544..1809

Additional Resources:

NCBI RefSeq record:
NM_028182.1
NBCI Gene record:
Sh2d4a (72281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251446 GATGACAAAGCCCAAACTAAA pLKO_005 1039 CDS 100% 13.200 18.480 N Sh2d4a n/a
2 TRCN0000251445 GATGAGAAGAGACGCTCTTTA pLKO_005 1183 CDS 100% 13.200 10.560 N Sh2d4a n/a
3 TRCN0000251444 GGAATCCCTCCAAAGTCTTTA pLKO_005 1342 CDS 100% 13.200 10.560 N Sh2d4a n/a
4 TRCN0000251448 GTCTGTTGGAGTGAGGTTATA pLKO_005 2321 3UTR 100% 13.200 9.240 N Sh2d4a n/a
5 TRCN0000251447 AGTCTCTAGAACTCGCCAATA pLKO_005 890 CDS 100% 10.800 7.560 N Sh2d4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.