Transcript: Mouse NM_028430.1

Mus musculus peptidylprolyl isomerase (cyclophilin)-like 6 (Ppil6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ppil6 (73075)
Length:
1093
CDS:
43..984

Additional Resources:

NCBI RefSeq record:
NM_028430.1
NBCI Gene record:
Ppil6 (73075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255153 AGACGACGGAGAGTCTATTTA pLKO_005 699 CDS 100% 15.000 21.000 N Ppil6 n/a
2 TRCN0000255155 CAACTCCTGGGTAACGCATTT pLKO_005 337 CDS 100% 10.800 15.120 N Ppil6 n/a
3 TRCN0000255152 GGGTGAAACCTGGGTCTATTC pLKO_005 288 CDS 100% 10.800 15.120 N Ppil6 n/a
4 TRCN0000255156 GAGTTCTTGGAATGGTCAATA pLKO_005 770 CDS 100% 13.200 9.240 N Ppil6 n/a
5 TRCN0000255154 AGTTTGCTTGGGATCAGTTTC pLKO_005 242 CDS 100% 10.800 7.560 N Ppil6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.