Transcript: Mouse NM_028499.2

Mus musculus leucine rich repeat containing 69 (Lrrc69), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lrrc69 (73314)
Length:
1210
CDS:
8..1051

Additional Resources:

NCBI RefSeq record:
NM_028499.2
NBCI Gene record:
Lrrc69 (73314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265326 GACCCAGTTGACGTTACTAAA pLKO_005 184 CDS 100% 13.200 18.480 N Lrrc69 n/a
2 TRCN0000251470 CATCGCTTGATCATGCTTAAT pLKO_005 326 CDS 100% 13.200 9.240 N Lrrc69 n/a
3 TRCN0000251472 CTCTGGACTCTACGGGAAATA pLKO_005 746 CDS 100% 13.200 9.240 N Lrrc69 n/a
4 TRCN0000251471 TAAGGAGTCTTACCTACTTAA pLKO_005 393 CDS 100% 13.200 9.240 N Lrrc69 n/a
5 TRCN0000265188 TGAGTGGCTGGAGTGCGTTTA pLKO_005 901 CDS 100% 10.800 7.560 N Lrrc69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.