Transcript: Mouse NM_029042.1

Mus musculus RIKEN cDNA 4930435E12 gene (4930435E12Rik), mRNA.

Source:
NCBI, updated 2016-07-26
Taxon:
Mus musculus (mouse)
Gene:
4930435E12Rik (74663)
Length:
1368
CDS:
5..1150

Additional Resources:

NCBI RefSeq record:
NM_029042.1
NBCI Gene record:
4930435E12Rik (74663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341684 GAACTTCACAACCACCTAATC pLKO_005 309 CDS 100% 10.800 15.120 N 4930435E12Rik n/a
2 TRCN0000341682 ACGTCCCAAGCACTGCTTACT pLKO_005 1157 3UTR 100% 4.950 6.930 N 4930435E12Rik n/a
3 TRCN0000341756 TACCCGAGTTAAACATATAAC pLKO_005 562 CDS 100% 0.000 0.000 N 4930435E12Rik n/a
4 TRCN0000341754 ACACAACATCCTGCATATATT pLKO_005 1018 CDS 100% 15.000 10.500 N 4930435E12Rik n/a
5 TRCN0000341755 TCAGCCAGCACTGACTATTTA pLKO_005 443 CDS 100% 15.000 10.500 N 4930435E12Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.