Transcript: Mouse NM_029290.1

Mus musculus RIKEN cDNA 1700011I03 gene (1700011I03Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2016-06-24
Taxon:
Mus musculus (mouse)
Gene:
1700011I03Rik (75444)
Length:
967
CDS:
28..843

Additional Resources:

NCBI RefSeq record:
NM_029290.1
NBCI Gene record:
1700011I03Rik (75444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347769 GAAAGTTGTAATCCCAGATAT pLKO_005 102 CDS 100% 13.200 18.480 N 1700011I03Rik n/a
2 TRCN0000347768 GAGAAACTTAACATCCATAAA pLKO_005 466 CDS 100% 13.200 18.480 N 1700011I03Rik n/a
3 TRCN0000347766 GGAAGTTATCAGTCATATATT pLKO_005 154 CDS 100% 15.000 10.500 N 1700011I03Rik n/a
4 TRCN0000347767 GACAGTGGACAGACAGTATTT pLKO_005 208 CDS 100% 13.200 9.240 N 1700011I03Rik n/a
5 TRCN0000347692 TGGAACTCAATGAGAAGATAA pLKO_005 563 CDS 100% 13.200 9.240 N 1700011I03Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.