Transcript: Mouse NM_029818.1

Mus musculus RIKEN cDNA 2700049A03 gene (2700049A03Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
2700049A03Rik (76967)
Length:
5499
CDS:
993..5291

Additional Resources:

NCBI RefSeq record:
NM_029818.1
NBCI Gene record:
2700049A03Rik (76967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342172 ACCATCCCACTACTGATATTT pLKO_005 3754 CDS 100% 15.000 21.000 N 2700049A03Rik n/a
2 TRCN0000342108 CGTTGCAAGACGAGGATTATA pLKO_005 2905 CDS 100% 15.000 21.000 N 2700049A03Rik n/a
3 TRCN0000342111 AGTACCCGTGCCGAAGTATAA pLKO_005 2294 CDS 100% 13.200 18.480 N 2700049A03Rik n/a
4 TRCN0000352658 AGCAACAGCAGATAGACATTC pLKO_005 1780 CDS 100% 10.800 6.480 N 2700049A03Rik n/a
5 TRCN0000342173 AGACTCATGAAGGCTTACAAG pLKO_005 5321 3UTR 100% 4.950 2.970 N 2700049A03Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.