Transcript: Mouse NM_029936.2

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 (Ddx10), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ddx10 (77591)
Length:
3368
CDS:
110..2737

Additional Resources:

NCBI RefSeq record:
NM_029936.2
NBCI Gene record:
Ddx10 (77591)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253136 ACGTTGGAACAGAACTATATA pLKO_005 968 CDS 100% 15.000 12.000 N Ddx10 n/a
2 TRCN0000253135 GAGGATGCCAACACGTATATT pLKO_005 1289 CDS 100% 15.000 12.000 N Ddx10 n/a
3 TRCN0000253139 AGAAGATGGAGAAGCGTTATT pLKO_005 1339 CDS 100% 13.200 9.240 N Ddx10 n/a
4 TRCN0000253138 ATGTGAGCAAGTTACCTATTA pLKO_005 1578 CDS 100% 13.200 9.240 N Ddx10 n/a
5 TRCN0000253137 TTTGATACCTCTGGATATTAC pLKO_005 2761 3UTR 100% 13.200 9.240 N Ddx10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029936.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.