Transcript: Mouse NM_029961.2

Mus musculus ATP-binding cassette, sub-family B (MDR/TAP), member 5 (Abcb5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Abcb5 (77706)
Length:
3876
CDS:
85..3852

Additional Resources:

NCBI RefSeq record:
NM_029961.2
NBCI Gene record:
Abcb5 (77706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255035 GGTTACACCATCGGAACTATT pLKO_005 1042 CDS 100% 13.200 18.480 N Abcb5 n/a
2 TRCN0000267522 TTCCGATTTGGAGCCTATTTG pLKO_005 2896 CDS 100% 13.200 18.480 N Abcb5 n/a
3 TRCN0000255034 TAATGGATGCCTAGTACAAAC pLKO_005 318 CDS 100% 10.800 15.120 N Abcb5 n/a
4 TRCN0000255036 TCATTGTGTTGACTCTATATT pLKO_005 395 CDS 100% 15.000 10.500 N Abcb5 n/a
5 TRCN0000267532 TTGATAAGAAACCCAATATAG pLKO_005 1175 CDS 100% 13.200 9.240 N Abcb5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029961.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.