Transcript: Mouse NM_030185.3

Mus musculus zinc finger, CCHC domain containing 4 (Zcchc4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Zcchc4 (78796)
Length:
5756
CDS:
37..1575

Additional Resources:

NCBI RefSeq record:
NM_030185.3
NBCI Gene record:
Zcchc4 (78796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238831 TGGATTACCAGGTGGATTATG pLKO_005 1031 CDS 100% 13.200 18.480 N Zcchc4 n/a
2 TRCN0000238829 GGTGGAACCTCTGGCTATTAC pLKO_005 876 CDS 100% 13.200 9.240 N Zcchc4 n/a
3 TRCN0000238828 TAGACTTGCTGCCCGAGAAAT pLKO_005 291 CDS 100% 13.200 9.240 N Zcchc4 n/a
4 TRCN0000238830 TATGTGGAAAGAAGGTCAAAG pLKO_005 915 CDS 100% 10.800 7.560 N Zcchc4 n/a
5 TRCN0000238827 AGTCCTGCCTTGACAGCTTTC pLKO_005 1631 3UTR 100% 6.000 3.600 N Zcchc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.