Transcript: Human NM_080607.3

Homo sapiens V-set and transmembrane domain containing 2 like (VSTM2L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VSTM2L (128434)
Length:
1936
CDS:
225..839

Additional Resources:

NCBI RefSeq record:
NM_080607.3
NBCI Gene record:
VSTM2L (128434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242574 GTGGGCCTCGAACCAGCTAAA pLKO_005 500 CDS 100% 3.600 5.040 N VSTM2L n/a
2 TRCN0000242571 TATTTCTATTGGACCCAATTC pLKO_005 1761 3UTR 100% 10.800 7.560 N VSTM2L n/a
3 TRCN0000242575 CAGCAACATCTCCCACAAGCT pLKO_005 584 CDS 100% 2.640 1.848 N VSTM2L n/a
4 TRCN0000242572 AGTGCCGCGTCATCGACTTCA pLKO_005 646 CDS 100% 1.650 1.155 N VSTM2L n/a
5 TRCN0000242573 GAGATCCAGTGGTGGTATGTA pLKO_005 447 CDS 100% 5.625 3.375 N VSTM2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.